Very nice. Works as advertised.
>gi|24497489
|ref|NM_003059.2|Gene info | UniGene info
| Geo Homo sapiens solute carrier family 22 (organic cation
transporter), member 4 (SLC22A4), mRNA
Length = 2214
Score = 557 bits (281), Expect = e-155
Identities = 551/641 (85%)
Strand = Plus / Plus
Query: 7 gactacgacgaggtgatcgccttcctgggcgagtggggccccttccagagactgatcttc 66
|||||||||||||||||||||||||||||||||||||| ||||||||| | || ||||||
Sbjct: 172 gactacgacgaggtgatcgccttcctgggcgagtgggggcccttccagcgcctcatcttc 231
Query: 67 ttcctgctgagcgccagcatcatccccaacggcttcaacggcatgagcgtggtgttcctg 126
|||||||| |||||||||||||||||||| |||||||| || ||| || |||||||||
Sbjct: 232 ttcctgctcagcgccagcatcatccccaatggcttcaatggtatgtcagtcgtgttcctg 291
Query: 127 gccggcacccccgagcacagatgcagagtgcccgacgccgccaacctgagcagcgcctgg 186
|| || ||||| |||||| | || ||||||| |||||||| ||||||||||||||||||
Sbjct: 292 gcggggaccccggagcaccgctgtcgagtgccggacgccgcgaacctgagcagcgcctgg 351
Query: 187 agaaacaacagcgtgcccctgagactgagagacggcagagaggtgccccacagctgcagc 246
| |||||||| || || ||| | ||| | |||||| | |||||||||||||||||||||
Sbjct: 352 cgcaacaacagtgtcccgctgcggctgcgggacggccgcgaggtgccccacagctgcagc 411
Query: 247 agatacagactggccaccatcgccaacttcagcgccctgggcctggagcccggcagagac 306
| ||| | || |||||||||||||||||| || || || |||||||| || | |||
Sbjct: 412 cgctaccggctcgccaccatcgccaacttctcggcgctcgggctggagccggggcgcgac 471
Query: 307 gtggacctgggccagctggagcaggagagctgcctggacggctgggagttcagccaggac 366
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 472 gtggacctggggcagctggagcaggagagctgcctggatggctgggagttcagccaggac 531
Query: 367 gtgtacctgagcaccgtggtgaccgagtggaacctggtgtgcgaggacaactggaaggtg 426
|| |||||| |||||| |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 532 gtctacctgtccaccgtcgtgaccgagtggaatctggtgtgtgaggacaactggaaggtg 591
Query: 427 cccctgaccaccagcctgttcttcgtgggcgtgctgctgggcagcttcgtgagcggccag 486
||||| |||||| |||||||||||| |||||||| || ||| ||||||| ||| |||
Sbjct: 592 cccctcaccacctccctgttcttcgtaggcgtgctcctcggctccttcgtgtccgggcag 651
Query: 487 ctgagcgacagattcggcagaaagaacgtgctgttcgccaccatggccgtgcagaccggc 546
||| ||||| || ||||| |||||||| || ||||| |||||||| || ||||| |||
Sbjct: 652 ctgtcagacaggtttggcaggaagaacgttctcttcgcaaccatggctgtacagactggc 711
Query: 547 ttcagcttcctgcagatcttcagcatcagctgggagatgttcaccgtgctgttcgtgatc 606
||||||||||||||||| ||| ||||||||||||||||||||| ||| | || || |||
Sbjct: 712 ttcagcttcctgcagattttctccatcagctgggagatgttcactgtgttatttgtcatc 771
Query: 607 gtgggcatgggccagatcagcaactacgtggtggccttcat 647
|||||||||||||||||| |||||| ||||| ||||||||
Sbjct: 772 gtgggcatgggccagatctccaactatgtggtagccttcat 812
Back to Wrangler
Shamelessly reusing code since 1995.
This website may not look very good in Internet Explorer or Netscape 4.n. That's because IE is broken and Netscape 4 doesn't support CSS. You can easily download better browsers. If you're on alf, Terry has kindly installed Mozilla. If you really must use IE, try turning on standards mode.
The code here is provided for personal use, at your own risk, I will not accept responsibility etc., etc. Personal cheques should be drawn on a UK bank and made payable to Richard P. Grant