Codon usage wrangler

TESTIMONIAL - Richard F. Wintle, PhD

  1. Used human OCTN1 (aka SLC22A4) - input the aa sequence (GenBank/Entrez Q9H015)
  2. ran your app
  3. took resulting nucleotide query and re-blasted vs. GenBank - net result is 85% identity at nucleotide level (see below); top BLAST score was the correct gene btw; I'm betting most of the incorrect positions were 3rd bases in codons although I admit I couldn't be arsed to check
  4. translating the derived nucleotide sequence into protein and reblasting of course yielded 100% identity with the original protein sequence

Very nice. Works as advertised.

>gi|24497489 |ref|NM_003059.2|Gene info | UniGene info | Geo Homo sapiens solute carrier family 22 (organic cation transporter), member 4 (SLC22A4), mRNA

Length = 2214

Score =  557 bits (281), Expect = e-155
Identities = 551/641 (85%)
Strand = Plus / Plus
 
                                                                       
Query: 7   gactacgacgaggtgatcgccttcctgggcgagtggggccccttccagagactgatcttc 66
           |||||||||||||||||||||||||||||||||||||| ||||||||| | || ||||||
Sbjct: 172 gactacgacgaggtgatcgccttcctgggcgagtgggggcccttccagcgcctcatcttc 231
 
                                                                       
Query: 67  ttcctgctgagcgccagcatcatccccaacggcttcaacggcatgagcgtggtgttcctg 126
           |||||||| |||||||||||||||||||| |||||||| || |||   || |||||||||
Sbjct: 232 ttcctgctcagcgccagcatcatccccaatggcttcaatggtatgtcagtcgtgttcctg 291
 
                                                                       
Query: 127 gccggcacccccgagcacagatgcagagtgcccgacgccgccaacctgagcagcgcctgg 186
           || || ||||| |||||| | ||  ||||||| |||||||| ||||||||||||||||||
Sbjct: 292 gcggggaccccggagcaccgctgtcgagtgccggacgccgcgaacctgagcagcgcctgg 351
 
                                                                       
Query: 187 agaaacaacagcgtgcccctgagactgagagacggcagagaggtgccccacagctgcagc 246
            | |||||||| || || ||| | ||| | |||||| | |||||||||||||||||||||
Sbjct: 352 cgcaacaacagtgtcccgctgcggctgcgggacggccgcgaggtgccccacagctgcagc 411
 
                                                                       
Query: 247 agatacagactggccaccatcgccaacttcagcgccctgggcctggagcccggcagagac 306
            | ||| | || ||||||||||||||||||   || || || |||||||| ||  | |||
Sbjct: 412 cgctaccggctcgccaccatcgccaacttctcggcgctcgggctggagccggggcgcgac 471
 
Query: 307 gtggacctgggccagctggagcaggagagctgcctggacggctgggagttcagccaggac 366
           ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 472 gtggacctggggcagctggagcaggagagctgcctggatggctgggagttcagccaggac 531
 
                                                                       
Query: 367 gtgtacctgagcaccgtggtgaccgagtggaacctggtgtgcgaggacaactggaaggtg 426
           || ||||||  |||||| |||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 532 gtctacctgtccaccgtcgtgaccgagtggaatctggtgtgtgaggacaactggaaggtg 591
 
                                                                       
Query: 427 cccctgaccaccagcctgttcttcgtgggcgtgctgctgggcagcttcgtgagcggccag 486
           ||||| ||||||  |||||||||||| |||||||| || |||  |||||||  ||| |||
Sbjct: 592 cccctcaccacctccctgttcttcgtaggcgtgctcctcggctccttcgtgtccgggcag 651
 
                                                                       
Query: 487 ctgagcgacagattcggcagaaagaacgtgctgttcgccaccatggccgtgcagaccggc 546
           |||   ||||| || ||||| |||||||| || ||||| |||||||| || ||||| |||
Sbjct: 652 ctgtcagacaggtttggcaggaagaacgttctcttcgcaaccatggctgtacagactggc 711
 
                                                                       
Query: 547 ttcagcttcctgcagatcttcagcatcagctgggagatgttcaccgtgctgttcgtgatc 606
           ||||||||||||||||| |||  ||||||||||||||||||||| ||| | || || |||
Sbjct: 712 ttcagcttcctgcagattttctccatcagctgggagatgttcactgtgttatttgtcatc 771
 
                                                    
Query: 607 gtgggcatgggccagatcagcaactacgtggtggccttcat 647
           ||||||||||||||||||  |||||| ||||| ||||||||
Sbjct: 772 gtgggcatgggccagatctccaactatgtggtagccttcat 812

Back to Wrangler

Shamelessly reusing code since 1995.

This website may not look very good in Internet Explorer or Netscape 4.n. That's because IE is broken and Netscape 4 doesn't support CSS. You can easily download better browsers. If you're on alf, Terry has kindly installed Mozilla. If you really must use IE, try turning on standards mode.
The code here is provided for personal use, at your own risk, I will not accept responsibility etc., etc. Personal cheques should be drawn on a UK bank and made payable to Richard P. Grant